Web Service logol SOAP Fr

aka LogolMatch aka LogolDesigner Add_annotation_inactiveAdd_annotation_inactiveLog in to add alternative_name
WARNING
Annotations: 48 Total number of annotations from the provider's definition / description document. 26 Total number of annotations submitted by members of BioCatalogue. 22 Total number of annotations sourced from other registries. 0

Example data for SOAP Input: 'launchJobInput' (on SOAP Operation: 'launchJob')

by olivier.sallou (about 9 years ago) Page_go
Logol grammar example: (search for repeats):
def:{
}
mod1()==>"aaa",repeat("acgt" ,[0,1])+
mod1()==*>SEQ1
by olivier.sallou (about 9 years ago) Page_go
Fasta input example:
>gi|51511735|ref|nc_000018.8|nc_000018 test sequence for logol validation
ccccaaaacgtacgtccccacgtaggtccccaccaccattt