This looks like a Soaplab service. Click here for more info and guidance on how to use this service )
About Soaplab
Soaplab services are command line applications, wrapped as SOAP services, and served from a Soaplab server. All Soaplab services have the same generic set of SOAP operations (depending on the Soaplab version) as they all share a standardised interface.
Certain tools, like the Taverna workflow workbench, provide automatic support for the Soaplab way of executing these services. In some cases you will need to use the Soaplab Server Base URL rather than the WSDL location in these tools.
More information on Soaplab clients is available here.
Further documentation on Soaplab services is available:
- Soaplab overview
- Soaplab client guide page
- EBI Soaplab server documentation
- Soaplab 2
- Sourceforge site for EMBOSS Soaplab services
Provider:
European Bioinformatics Institute (EMBL-EBI)
Location:
United Kingdom
Submitter/Source:
SoapLab Support (over 11 years ago)
Base URL:
http://www.ebi.ac.uk:80/soaplab/typed/services/nucleic_primers.eprimer3
WSDL Location:
http://www.ebi.ac.uk/soaplab/typed/services/nucleic_primers.eprimer3?wsdl(download last cached WSDL file)
Documentation URL(s): SoapLab Support (over 10 years ago) http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/eprimer3.html Login to add a documentation URL Description(s): from provider’s description doc (over 10 years ago) Picks PCR primers and hybridization oligos
SoapLab Support(over 10 years ago)
Picks PCR primers and hybridization oligos
Login to add a description ELIXIR Description(s): No info yet Login to add an elixir description Details (from Soaplab server): from Soaplab server(over 10 years ago)
- ds_lsr_analysis :
- analysis :
- name : eprimer3
- installation : Soaplab2 default installation
- type : Nucleic Primers
- output :
- description : Picks PCR primers and hybridization oligos
- version : 6.1.0
- analysis_extension :
- input :
- analysis :
- ds_lsr_analysis :
- analysis :
- name : eprimer3
- installation : Soaplab2 default installation
- type : Nucleic Primers
- output :
- description : Picks PCR primers and hybridization oligos
- version : 6.1.0
- analysis_extension :
- option :
- name : emboss
- type : normal
- value : true
- name : installation
- type : normal
- value : Soaplab2 default installation
- name : version
- type : normal
- value : 6.1.0
- event :
- action :
- id : _E_1
- app_info :
- category : nucleic_primers
- help_url : http://emboss.sourceforge.net/apps/release/6.1/emboss/apps/eprimer3.html
- parameter :
- data :
- list :
- list_item :
- level : 0
- value : gcg
- level : 0
- value : gcg8
- level : 0
- value : embl
- level : 0
- value : swiss
- level : 0
- value : fasta
- level : 0
- value : ncbi
- level : 0
- value : genbank
- level : 0
- value : nbrf
- level : 0
- value : pir
- level : 0
- value : codata
- level : 0
- value : strider
- level : 0
- value : clustal
- level : 0
- value : phylip
- level : 0
- value : acedb
- level : 0
- value : msf
- level : 0
- value : jackknifer
- level : 0
- value : jackknifernon
- level : 0
- value : nexus
- level : 0
- value : nexusnon
- level : 0
- value : treecon
- level : 0
- value : mega
- level : 0
- value : meganon
- level : 0
- value : ig
- level : 0
- value : staden
- level : 0
- value : text
- level : 0
- value : raw
- type : full
- list_item :
- list :
- base :
- data :
- result :
- iotype : output
- base :
- base :
- name : primer
- help : Tell EPrimer3 to pick primer(s)
- default : false
- mandatory : false
- qualifier : primer
- prompt : Pick PCR primer(s)
- type : boolean
- ordering : 3
- standard :
- list :
- name : Task
- list_item :
- level : 0
- shown_as : Pick PCR primers
- value : 1
- level : 0
- shown_as : Pick forward primer only
- value : 2
- level : 0
- shown_as : Pick reverse primer only
- value : 3
- level : 0
- shown_as : No primers needed
- value : 4
- type : full
- repeatable :
- list :
- base :
- base :
- name : hybridprobe
- help : An ‘internal oligo’ is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification.
- default : false
- mandatory : false
- qualifier : hybridprobe
- prompt : Pick hybridization probe
- type : boolean
- ordering : 5
- data :
- ioformat : unspecified
- iotype : input
- repeatable :
- base :
- data :
- ioformat : unspecified
- iotype : input
- repeatable :
- base :
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : numreturn
- help : The maximum number of primer pairs to return. Primer pairs returned are sorted by their ‘quality’, in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.
- default : 5
- mandatory : false
- qualifier : numreturn
- prompt : Number of results to return
- type : long
- ordering : 11
- standard :
- repeatable :
- base :
- standard :
- repeatable :
- base :
- standard :
- repeatable :
- base :
- standard :
- repeatable :
- base :
- standard :
- repeatable :
- base :
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : gcclamp
- help : Require the specified number of consecutive Gs and Cs at the 3′ end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.)
- default : 0
- mandatory : false
- qualifier : gcclamp
- prompt : GC clamp
- type : long
- ordering : 21
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : osize
- help : Optimum length (in bases) of a primer oligo. EPrimer3 will attempt to pick primers close to this length.
- default : 20
- mandatory : false
- qualifier : osize
- prompt : Primer optimum size
- type : long
- ordering : 22
- range :
- format : %d
- min : 1
- repeatable :
- base :
- name : minsize
- help : Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE.
- default : 18
- option :
- name : scalemin
- type : style
- value : 1
- mandatory : false
- qualifier : minsize
- prompt : Primer minimum size
- type : long
- ordering : 23
- range :
- format : %d
- max : 35
- min :
- repeatable :
- base :
- name : maxsize
- help : Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3’s melting-temperature is valid.
- default : 27
- option :
- name : calculated_hardmin
- type : normal
- value : ${minsize}
- name : scalemax
- type : style
- value : 35
- mandatory : false
- qualifier : maxsize
- prompt : Primer maximum size
- type : long
- ordering : 24
- range :
- format : %f
- repeatable :
- base :
- name : otm
- help : Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.
- default : 60.0
- mandatory : false
- qualifier : otm
- prompt : Primer optimum Tm
- type : float
- ordering : 25
- range :
- format : %f
- repeatable :
- base :
- name : mintm
- help : Minimum acceptable melting temperature(Celsius) for a primer oligo.
- default : 57.0
- mandatory : false
- qualifier : mintm
- prompt : Primer minimum Tm
- type : float
- ordering : 26
- range :
- format : %f
- min :
- repeatable :
- base :
- name : maxtm
- help : Maximum acceptable melting temperature(Celsius) for a primer oligo.
- default : 63.0
- option :
- name : calculated_hardmin
- type : normal
- value : ${mintm}
- mandatory : false
- qualifier : maxtm
- prompt : Primer maximum Tm
- type : float
- ordering : 27
- range :
- format : %f
- repeatable :
- base :
- name : maxdifftm
- help : Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers.
- default : 100.0
- mandatory : false
- qualifier : maxdifftm
- prompt : Maximum difference in Tm of primers
- type : float
- ordering : 28
- range :
- format : %f
- repeatable :
- base :
- name : ogcpercent
- help : Primer optimum GC percent.
- default : 50.0
- mandatory : false
- qualifier : ogcpercent
- prompt : Primer optimum GC percent
- type : float
- ordering : 29
- range :
- format : %f
- repeatable :
- base :
- name : mingc
- help : Minimum allowable percentage of Gs and Cs in any primer.
- default : 20.0
- mandatory : false
- qualifier : mingc
- prompt : Primer minimum GC percent
- type : float
- ordering : 30
- range :
- format : %f
- min :
- repeatable :
- base :
- name : maxgc
- help : Maximum allowable percentage of Gs and Cs in any primer generated by Primer.
- default : 80.0
- option :
- name : calculated_hardmin
- type : normal
- value : ${mingc}
- mandatory : false
- qualifier : maxgc
- prompt : Primer maximum GC percent
- type : float
- ordering : 31
- range :
- format : %f
- repeatable :
- base :
- name : saltconc
- help : The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures.
- default : 50.0
- mandatory : false
- qualifier : saltconc
- prompt : Salt concentration (mM)
- type : float
- ordering : 32
- range :
- format : %f
- repeatable :
- base :
- name : dnaconc
- help : The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research–0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to ‘c’ in Rychlik, Spencer and Rhoads’ equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is ’empirically determined’. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS.
- default : 50.0
- mandatory : false
- qualifier : dnaconc
- prompt : DNA concentration (nM)
- type : float
- ordering : 33
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : maxpolyx
- help : The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA.
- default : 5
- mandatory : false
- qualifier : maxpolyx
- prompt : Maximum polynucleotide repeat
- type : long
- ordering : 34
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : psizeopt
- help : The optimum size for the PCR product. 0 indicates that there is no optimum product size.
- default : 200
- mandatory : false
- qualifier : psizeopt
- prompt : Product optimum size
- type : long
- ordering : 37
- standard :
- repeatable :
- base :
- range :
- format : %f
- repeatable :
- base :
- name : ptmopt
- help : The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature.
- default : 0.0
- mandatory : false
- qualifier : ptmopt
- prompt : Product optimum Tm
- type : float
- ordering : 39
- range :
- format : %f
- repeatable :
- base :
- name : ptmmin
- help : The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details.
- default : -1000000.0
- mandatory : false
- qualifier : ptmmin
- prompt : Product minimum Tm
- type : float
- ordering : 40
- range :
- format : %f
- min :
- repeatable :
- base :
- name : ptmmax
- help : The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) – 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions.
- default : 1000000.0
- option :
- name : calculated_hardmin
- type : normal
- value : ${ptmmin}
- mandatory : false
- qualifier : ptmmax
- prompt : Product maximum Tm
- type : float
- ordering : 41
- standard :
- repeatable :
- base :
- standard :
- repeatable :
- base :
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : osizeopt
- help : Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers close to this length.
- default : 20
- mandatory : false
- qualifier : osizeopt
- prompt : Internal oligo optimum size
- type : long
- ordering : 48
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : ominsize
- help : Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE.
- default : 18
- mandatory : false
- qualifier : ominsize
- prompt : Internal oligo minimum size
- type : long
- ordering : 49
- range :
- format : %d
- max : 35
- min :
- repeatable :
- base :
- name : omaxsize
- help : Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3’s melting-temperature is valid.
- default : 27
- option :
- name : calculated_hardmin
- type : normal
- value : ${ominsize}
- name : scalemax
- type : style
- value : 35
- mandatory : false
- qualifier : omaxsize
- prompt : Internal oligo maximum size
- type : long
- ordering : 50
- range :
- format : %f
- repeatable :
- base :
- name : otmopt
- help : Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.
- default : 60.0
- mandatory : false
- qualifier : otmopt
- prompt : Internal oligo optimum Tm
- type : float
- ordering : 51
- range :
- format : %f
- repeatable :
- base :
- name : otmmin
- help : Minimum acceptable melting temperature(Celsius) for an internal oligo.
- default : 57.0
- mandatory : false
- qualifier : otmmin
- prompt : Internal oligo minimum Tm
- type : float
- ordering : 52
- range :
- format : %f
- min :
- repeatable :
- base :
- name : otmmax
- help : Maximum acceptable melting temperature (Celsius) for an internal oligo.
- default : 63.0
- option :
- name : calculated_hardmin
- type : normal
- value : ${otmmin}
- mandatory : false
- qualifier : otmmax
- prompt : Internal oligo maximum Tm
- type : float
- ordering : 53
- range :
- format : %f
- repeatable :
- base :
- name : ogcopt
- help : Internal oligo optimum GC percent.
- default : 50.0
- mandatory : false
- qualifier : ogcopt
- prompt : Internal oligo optimum GC percent
- type : float
- ordering : 54
- range :
- format : %f
- repeatable :
- base :
- name : ogcmin
- help : Minimum allowable percentage of Gs and Cs in an internal oligo.
- default : 20.0
- mandatory : false
- qualifier : ogcmin
- prompt : Internal oligo minimum GC
- type : float
- ordering : 55
- range :
- format : %f
- min :
- repeatable :
- base :
- name : ogcmax
- help : Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.
- default : 80.0
- option :
- name : calculated_hardmin
- type : normal
- value : ${ogcmin}
- mandatory : false
- qualifier : ogcmax
- prompt : Internal oligo maximum GC
- type : float
- ordering : 56
- range :
- format : %f
- repeatable :
- base :
- name : osaltconc
- help : The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures.
- default : 50.0
- mandatory : false
- qualifier : osaltconc
- prompt : Internal oligo salt concentration (mM)
- type : float
- ordering : 57
- range :
- format : %f
- repeatable :
- base :
- name : odnaconc
- help : The nanomolar concentration of annealing internal oligo in the hybridization.
- default : 50.0
- mandatory : false
- qualifier : odnaconc
- prompt : Internal oligo DNA concentration (nM)
- type : float
- ordering : 58
- range :
- format : %f
- max : 9999.99
- repeatable :
- base :
- name : oanyself
- help : The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5′ ATCGNA 3′ || | | 3′ TA-CGT 5′ is allowed (and yields a score of 1.75), but the alignment 5′ ATCCGNA 3′ || | | 3′ TA–CGT 5′ is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.
- default : 12.00
- option :
- name : scalemax
- type : style
- value : 9999.99
- mandatory : false
- qualifier : oanyself
- prompt : Internal oligo maximum self complementarity
- type : float
- ordering : 59
- range :
- format : %f
- max : 9999.99
- min :
- repeatable :
- base :
- name : oendself
- help : The maximum allowable 3′-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3′-anchored global alignment between two oligos. In order to estimate 3′-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5′ to 3′. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY.
- default : 12.00
- option :
- name : calculated_hardmin
- type : normal
- value : ${oanyself}
- name : scalemax
- type : style
- value : 9999.99
- mandatory : false
- qualifier : oendself
- prompt : Internal oligo maximum 3′ self complementarity
- type : float
- ordering : 60
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : opolyxmax
- help : The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA.
- default : 5
- mandatory : false
- qualifier : opolyxmax
- prompt : Internal oligo maximum polynucleotide repeat
- type : long
- ordering : 61
- range :
- format : %f
- max : 9999.99
- repeatable :
- base :
- name : omishybmax
- help : Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
- default : 12.0
- option :
- name : scalemax
- type : style
- value : 9999.99
- mandatory : false
- qualifier : omishybmax
- prompt : Internal oligo maximum mishybridization
- type : float
- ordering : 62
- base :
- name : explainflag
- help : If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons.
- default : false
- mandatory : false
- qualifier : explainflag
- prompt : Explain flag
- type : boolean
- ordering : 66
- base :
- name : fileflag
- help : If the associated value is true, then EPrimer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence-id).int, which lists all acceptable internal oligos.
- default : false
- mandatory : false
- qualifier : fileflag
- prompt : Create results files for each sequence
- type : boolean
- ordering : 67
- range :
- format : %d
- repeatable :
- base :
- name : firstbaseindex
- help : This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.)
- default : 1
- mandatory : false
- qualifier : firstbaseindex
- prompt : First base index
- type : long
- ordering : 68
- base :
- name : pickanyway
- help : If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints.
- default : false
- mandatory : false
- qualifier : pickanyway
- prompt : Pick anyway
- type : boolean
- ordering : 69
- range :
- format : %f
- max : 9999.99
- repeatable :
- base :
- name : maxmispriming
- help : The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.
- default : 12.00
- option :
- name : scalemax
- type : style
- value : 9999.99
- mandatory : false
- qualifier : maxmispriming
- prompt : Primer maximum mispriming
- type : float
- ordering : 70
- range :
- format : %f
- max : 9999.99
- repeatable :
- base :
- name : pairmaxmispriming
- help : The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY.
- default : 24.00
- option :
- name : scalemax
- type : style
- value : 9999.99
- mandatory : false
- qualifier : pairmaxmispriming
- prompt : Primer pair maximum mispriming
- type : float
- ordering : 71
- range :
- format : %d
- min : 0
- repeatable :
- base :
- name : numnsaccepted
- help : Maximum number of unknown bases (N) allowable in any primer.
- default : 0
- mandatory : false
- qualifier : numnsaccepted
- prompt : Maximum Ns accepted in a primer
- type : long
- ordering : 72
- range :
- format : %f
- max : 9999.99
- min : 0.00
- repeatable :
- base :
- name : selfany
- help : The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5′ ATCGNA 3′ …|| | | 3′ TA-CGT 5′ is allowed (and yields a score of 1.75), but the alignment 5′ ATCCGNA 3′ …|| | | 3′ TA–CGT 5′ is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.
- default : 8.00
- option :
- name : scalemax
- type : style
- value : 9999.99
- name : scalemin
- type : style
- value : 0.00
- mandatory : false
- qualifier : selfany
- prompt : Maximum self complementarity
- type : float
- ordering : 73
- range :
- format : %f
- max :
- min : 0.00
- repeatable :
- base :
- name : selfend
- help : The maximum allowable 3′-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3′-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3′-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5′ ATGCCCTAGCTTCCGGATG 3′ ………….||| ||||| ……….3′ AAGTCCTACATTTAGCCTAGT 5′ or 5′ AGGCTATGGGCCTCGCGA 3′ ……………|||||| …………3′ AGCGCTCCGGGTATCGGA 5′ The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3′-anchored global alignment between two oligos. In order to estimate 3′-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5′ to 3′. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.
- default : 3.00
- option :
- name : calculated_hardmax
- type : normal
- value : ${selfany}
- name : scalemin
- type : style
- value : 0.00
- mandatory : false
- qualifier : selfend
- prompt : Maximum 3′ self complementarity
- type : float
- ordering : 74
- range :
- format : %f
- max : 999.9999
- repeatable :
- base :
- name : maxendstability
- help : The maximum stability for the five 3′ bases of a forward or reverse primer. Bigger numbers mean more stable 3′ ends. The value is the maximum delta G for duplex disruption for the five 3′ bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, ‘Selection of Primers for Polymerase Chain Reaction’ in BA White, Ed., ‘Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications’, 1993, pp 31-40, Humana Press, Totowa NJ).
- default : 9.0
- option :
- name : scalemax
- type : style
- value : 999.9999
- mandatory : false
- qualifier : maxendstability
- prompt : Maximum 3′ end stability
- type : float
- ordering : 76
- data :
- option :
- input :
- name : primer
- default : false
- mandatory : false
- type : boolean
- name : hybridprobe
- default : false
- mandatory : false
- type : boolean
- name : numreturn
- default : 5
- mandatory : false
- type : long
- name : gcclamp
- default : 0
- mandatory : false
- type : long
- name : osize
- default : 20
- mandatory : false
- type : long
- name : minsize
- default : 18
- mandatory : false
- type : long
- name : maxsize
- default : 27
- mandatory : false
- type : long
- name : otm
- default : 60.0
- mandatory : false
- type : float
- name : mintm
- default : 57.0
- mandatory : false
- type : float
- name : maxtm
- default : 63.0
- mandatory : false
- type : float
- name : maxdifftm
- default : 100.0
- mandatory : false
- type : float
- name : ogcpercent
- default : 50.0
- mandatory : false
- type : float
- name : mingc
- default : 20.0
- mandatory : false
- type : float
- name : maxgc
- default : 80.0
- mandatory : false
- type : float
- name : saltconc
- default : 50.0
- mandatory : false
- type : float
- name : dnaconc
- default : 50.0
- mandatory : false
- type : float
- name : maxpolyx
- default : 5
- mandatory : false
- type : long
- name : psizeopt
- default : 200
- mandatory : false
- type : long
- name : ptmopt
- default : 0.0
- mandatory : false
- type : float
- name : ptmmin
- default : -1000000.0
- mandatory : false
- type : float
- name : ptmmax
- default : 1000000.0
- mandatory : false
- type : float
- name : osizeopt
- default : 20
- mandatory : false
- type : long
- name : ominsize
- default : 18
- mandatory : false
- type : long
- name : omaxsize
- default : 27
- mandatory : false
- type : long
- name : otmopt
- default : 60.0
- mandatory : false
- type : float
- name : otmmin
- default : 57.0
- mandatory : false
- type : float
- name : otmmax
- default : 63.0
- mandatory : false
- type : float
- name : ogcopt
- default : 50.0
- mandatory : false
- type : float
- name : ogcmin
- default : 20.0
- mandatory : false
- type : float
- name : ogcmax
- default : 80.0
- mandatory : false
- type : float
- name : osaltconc
- default : 50.0
- mandatory : false
- type : float
- name : odnaconc
- default : 50.0
- mandatory : false
- type : float
- name : oanyself
- default : 12.00
- mandatory : false
- type : float
- name : oendself
- default : 12.00
- mandatory : false
- type : float
- name : opolyxmax
- default : 5
- mandatory : false
- type : long
- name : omishybmax
- default : 12.0
- mandatory : false
- type : float
- name : explainflag
- default : false
- mandatory : false
- type : boolean
- name : fileflag
- default : false
- mandatory : false
- type : boolean
- name : firstbaseindex
- default : 1
- mandatory : false
- type : long
- name : pickanyway
- default : false
- mandatory : false
- type : boolean
- name : maxmispriming
- default : 12.00
- mandatory : false
- type : float
- name : pairmaxmispriming
- default : 24.00
- mandatory : false
- type : float
- name : numnsaccepted
- default : 0
- mandatory : false
- type : long
- name : selfany
- default : 8.00
- mandatory : false
- type : float
- name : selfend
- default : 3.00
- mandatory : false
- type : float
- name : maxendstability
- default : 9.0
- mandatory : false
- type : float
- analysis :
License(s): No info yet Login to add license info Cost: No info yet Login to add cost info Usage conditions: No info yet Login to add usage conditions info Contact info: No info yet Login to add contact info How to cite this service: No info yet Login to add how to cite info Publications about this service: for this service (this can be in a common citation format like Bibtex, MLA or APA, a DOI, a URL, etc.) No info yet Login to add publications info Citations of this service: No info yet Login to add citations info Example workflows using this service: See all workflows on myExperiment that use this service Login to add workflows info